Created: 1st September 2000, last updated: 30th October 2000, © 2000 ABRF

METHODS AND REVIEWS


 

Sequencing Telomeric DNA Template With Short Tandem Repeats Using Dye Terminator Cycle Sequencing

Xiaolan Zhao, Talat Haqqi, and Satya P. Yadav

Molecular Biotechnology Core, The Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH

The standard DNA sequencing methods for use in conjunction with commercially available sequencing kits are effective in sequencing a majority of templates. However, templates rich in dinucleotide and tetranucleotide repeats and a telomeric DNA containing tandem repeats are difficult to sequence adequately using these methods. Base compression artifacts due to formation of secondary structure on the nascent strands and slippage of the DNA polymerase accompanied by premature chain termination in homopolymer and short tandem repeat regions of DNA are commonly encountered problems in sequencing core laboratories. In an attempt to sequence such repeat regions of telomeric DNA templates using dye terminator chemistry, we investigated the effect of increasing the annealing time and temperature in combination with the use of denaturing conditions. Specifically, we compared the commonly used ABI PRISM BigDye, dGTP BigDye, and DYEnamic ET terminator chemistries for sequencing telomeric DNA templates rich in CA- and AACCCC-type repeats and for sequencing a template rich in dinucleotide (GT and CT) and tetranucleotide repeats. The routine reaction protocol was modified by adding either 1 M 1-carboxy-N,N,N-trimethylmethanaminium inner salt (betaine) or 5% dimethyl sulfoxide (DMSO) as denaturants in the reaction mixture. In addition, the annealing and denaturation times were increased to allow successful primer extension for linear growth of sequencing reaction product. Many of the artifacts in sequencing are known to be due to reduced stability of the hybrid formed between the template and the nascent strand. The effects of using denaturants to break secondary structures in the nascent chain and of increasing the denaturation and annealing times are discussed. We were able to sequence DNA templates with tandem repeats that failed to sequence under routine reaction conditions. (J Biomol Tech 2000;11:111-121)

Key Words: DNA sequencing, telomeric DNA, repeat sequences, betaine, dimethyl sulfoxide (DMSO).

Address correspondence and reprint requests to: Satya P. Yadav, Molecular Biotechnology Core, The Lerner Research Institute, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195 (email: yadavs@cesmtp.ccf.org).

 

DNA sequencing core laboratories have become important resources for various ongoing genome projects. A number of DNA sequencing core facilities have switched to automated sequencing methods using the fluorescent BigDye, dGTP BigDye, or DYEnamic ET terminator sequencing chemistry.1 DNA samples received by the core facilities vary in quality because they originate from multiple laboratories that use a variety of protocols for preparing DNA templates. Some samples fail to produce sequence data because templates are of poor quality. However, DNA templates that are rich in GC base pairs, dinucleotide repeats, Alu repeats, and short tandem repeats further hinder sequencing. Sequencing of several genomes, including those of Saccharomyces cerevisiae, Drosophila spp., Caenorhabditis elegans, certain human chromosomes, and more than 25 free-living bacteria have now been completed, and the Human Genome Project is rapidly approaching a "draft sequence." Whereas the accuracy of sequences produced by various genome-sequencing centers is very high, sequencing of the more challenging telomeric and centromeric regions and certain other unfinished regions are scheduled for later completion. The unfinished sequence gaps are rapidly accumulating, particularly in centromeric and telomeric regions.2 Sequencing such regions is much more difficult because of the presence of highly repetitive DNA.3 However, centromeric regions have many important genes that often are present only in single copy.4 Centromeric regions in vertebrates and plants have been shown to contain telomeric-type sequences.5,6 The telomeres with variable simple repeat sequences are characterized by clusters of G residues on the 3'-end of each strand of eukaryotic chromosomal DNA. These variable numbers of simple repeats are synthesized by a cellular telomerase, by a reverse transcriptase, or by adding noncoding sequences to chromosome ends to maintain the neighboring coding regions intact.7,8 Recently introduced sequencing technologies are effective in sequencing homopolymers, dinucleotide repeats, and trinucleotide repeats, but tandem repeats of more than 30 bases fail to sequence using routine methods.9

The DNA Sequencing Research Group (DSRG) of the Association of Biomolecular Resource Facilities (ABRF) has previously evaluated various methods to sequence difficult templates containing more than 70% GC.9,10 However, many DNA templates with microsatellite tandem repeats also fail to produce sequence data by routine laboratory protocols. We report that changing annealing times in standard sequencing protocols and using denaturation conditions are sufficient to sequence telomeric sequences of more than 530 bp in length. Sequencing data acquired after modification of annealing time, temperature, and denaturation conditions using BigDye, dGTP BigDye, and DYEnamic ET terminator cycle sequencing are presented.

 

MATERIALS AND METHODS

Materials

Long Ranger gel solution (50% stock) was purchased from FMC BioProducts (Rockland, ME). TBE 10X ready buffer packs were purchased from Ameresco (Solon, OH). N,N,N,N'-tetramethylethylenediamide, dimethyl sulfoxide (DMSO), 1-carboxy-N,N,N-trimethylmethanaminium inner salt (betaine), and formamide were purchased from Sigma (St. Louis, MO). Ammonium persulfate and Ag 501-X8 resin were purchased from Bio-Rad Laboratories (Hercules, CA). Urea was purchased from USB Corporation (Cleveland, OH). Centriflex cartridges were obtained from Edge Biosystems (Gaithersberg, MD). The YAC DNA template with the telomeric sequence used in this study was provided by Kurt Runge, Lerner Research Institute (LRI). The GenBank accession number for this sequence is AF163941. The primer used for sequencing the telomeric DNA was 5'-GTTGGTTTAAGGCGCAAGAC-3'. The DNA template containing dinucleotide and tetranucleotide repeats was from mouse beta-defensin 4 gene cloned in pBluescript plasmid and was provided by Charles Bevins, LRI. The template was sequenced with the T7 universal primer 5'-TAATACGACTCACTATAGGG-3'. The GenBank accession number for the gene is AF287475. BigDye and dGTP Terminator Ready Reaction Kits were purchased from PE Biosystems (Foster City, CA), and the DYEnamic ET terminator cycle sequencing kit was purchased from Amersham Pharmacia Biotech (Piscataway, NJ).

Cycle Sequencing Methods

The BigDye terminator sequencing reactions were performed in thin-walled, 0.2-mL, sterilized microfuge tubes (United Scientific Products, San Leandro, CA) by adding the following: 1.3 µg DNA, 5 pmol primer, 8 µL BigDye terminator ready reaction premix containing AmpliTaq DNA polymerase, 5% dimethyl sulfoxide (DMSO) or 1 M betaine (final concentration), and MilliQ water (Millipore, Bedford, MA); the total reaction volume was 20 µL. The liquid was centrifuged to the bottom of the tube by spinning at 5000 rpm for 1 minute. Tubes were preheated at 96°C for 2 minutes, and then 30 cycles of polymerase chain reaction (PCR) were performed, each consisting of denaturation at 98°C for 30 seconds, annealing at 50°C for 15 seconds, and extension at 60°C for 4 minutes. The excess dye terminators were removed from the reaction products with Centriflex cartridges (Edge Biosystems). The purified extension products were dried in a Speed Vac (Savant, Holbrook, NY), and resuspended in the loading buffer. The samples were loaded on 36-cm plates with 5.25% Long Ranger gel and run for 7 hours on a PE Biosystems Model 377XL sequencer. Base calling was done automatically with the manufacturer's version 3.3 sequence analysis software.

The typical DYEnamic ET terminator reaction was performed according to the protocol provided by Amersham Pharmacia Biotech. After mixing all the reaction components, liquid was centrifuged to the bottom of the tube by spinning at 5000 rpm for 1 minute. Thermal cycling consisted of 25 cycles at 95°C for 20 seconds, 50°C for 15 seconds, and 60°C for 1 minute. The reaction products were again separated from excess dye terminators using a Centriflex cartridge from Edge Biosystems.

 

RESULTS

The results obtained with various reaction conditions and the sequencing chemistries in sequencing two DNA templates rich in GT, CT, and AC dinucleotides; CTTT and TTCC tetranucletotides; and AACCCC tandem repeats are summarized in Table 1.

 

TABLE 1
Sequencing Conditions


Sequencing Resultsa
Sequencing Annealing Annealing Denaturation Denaturation
Chemistry     Temperature (°C)     Time (min)     Temperature (°C)     Time (min)     Denaturant     T#1b     T#2c

BigDye 50 5 98 10 5% DMSO 531 bp NS
dGTP 50 5 98 10 5% DMSO 320 bpd --
BigDye 50 15 98 30 None -- NS
BigDye 50 15 98 30 5% DMSO 320 bpd 454 bp
BigDye 50 15 98 30 1 M betaine 588 bp 504 bp
dGTP 50 15 98 30 5% DMSO 320 bpd 405 bp
dGTP 50 15 98 30 1 M betaine 320 bpd --
BigDye 55 15 98 30 5% DMSO -- 397 bp
BigDye 55 15 98 30 1 M betaine -- 364 bp
DYEnamic 50 15 95 20 ND -- NS
DYEnamic 50 15 95 20 5% DMSO -- NS

The extension reaction for BigDye and dGTP chemistry was performed at 60°C for 4 minutes, whereas for DYEnamic chemistry, the extension reaction was done at 60°C for 1 minute. The sequencing reactions for BigDye were performed by preheating at 96°C for 2 min. No preheating was done for DYEnamic reactions.
aUnambiguous read-length in base pairs (bp).
bDNA template with GT- and CT-type dinucleotide and CTTT- and TTCC-type tetranucleotide repeats.
cDNA template with (AC)n and AACCCC tandem repeats.
dSeveral ambiguous base calls (Ns) from 320 bp onward.
NS, no interpretable sequence; ND, not done; DMSO, dimethyl sulfoxide.

 

GT- and CT-Type Dinucleotide and CTTT- and TTCC-Type Tetranucleotide Repeats

Sequencing results for the DNA template with GT- and CT-type dinucleotide and CTTT- and TTCC-tetranucleotide repeats are presented in Figures 1 and 2. Figures 3 and 4 show examples of sequencing data acquired within the TTCC tetranucleotide repeat region (320-350 bp) of the template using BigDye and dGTP BigDye terminator chemistries, respectively. As shown in Figure 2, signal strength declined in the 30-bp GT dinucleotide repeat region (underlined in Fig. 1), but remained stable in the 60-bp CTTT tetranucleotide repeat following (217-276 bp). The signal further weakened in the 44-bp CT dinucleotide repeat region after the CTTT repeat and became unreadable in the next 24-bp TTCC tetranucleotide repeat (Fig. 3B and Fig. 4A and B. Generally, a weak C signal was observed after a T base. The first C peak became obscured after the TT dinucleotide sequence, particularly in the TTCC repeat region, giving it an ambiguous miscall (N). As shown in Figure 3B, with 5% DMSO in the reaction mixture, bases 323, 325, 330, and 346 were not identified, and bases 334, 338, and 342 were identified as T instead of C. However, addition of 1 M betaine in the reaction mixture produced better data, as shown in Figure 3A, although the peak signal gradually weakened in the tetranucleotide repeat region. The template was also sequenced using the dGTP BigDye terminator chemistry in the presence of 5% DMSO or 1 M betaine. Sequencing with dGTP chemistry in the presence of either 5% DMSO or 1 M betaine was not effective in resolving the base ambiguities (Ns) in the tetranucleotide repeat region between 322 and 343 bp under similar sequencing conditions (Fig. 4). The gradual signal loss may have been due to the region of secondary structure in the template or other template sequence idiosyncrasies.11

ACACNTGTGTACCGGGCCCCCCCTCGAGGTCGACGGTATC 40

GATAAGCTTGATATCGAATTCCTGCAGCCCCCTGGTGCTG 80

CTGTCTCCACTTGCAGGTGAGTCAGGGGAATAGGATGGTC 120

CCACACTGATATGAGAGACAGCACCCTACCCGGTGTGTGT 160

GTGTGTGTGTGTGTGTGTGTGTGTAGCTTTATGTGTCTCT 200

GTGTATGCCTCTTTGTCTTTCTTTCTTTCTTTCTTTCTTT 240

CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCT 280

CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 320

CTTCCTTCCTTCCTTCCTTCCTTCCCCCCTCTCTTTCTTT 360

CAAGATTTATTTATTTATTTTATGTATGTGAATACATTCT 400

FIGURE 1. Sequence of the template with dinucleotide and tetranucleotide repeats.

 

FIGURE 2. Representative electropherogram of DNA template rich in GT- and CT-type dinucleotide and CTTT- and CCTT-type tetranucleotide repeats. The template was sequenced in the presence of 1 M betaine under cycling conditions as follows: preheat tubes at 96°C for 2 minutes, followed by polymerase chain reaction cycles consisting of denaturation at 98°C for 30 seconds, annealing at 50°C for 15 seconds, and extension at 60°C for 4 minutes.

 

FIGURE 3. Sequencing DNA template containing repeats using BigDye terminator chemistry. DNA template rich in CT- and CCTT-type repeats was sequenced in the presence of (A) 1 M betaine and (B) 5% dimethyl sulfoxide in a 20-µL reaction mix. Cycling conditions were as follows: preheat tubes at 96°C for 2 minutes, followed by 30 polymerase chain reaction cycles consisting of denaturation at 98°C for 30 seconds, annealing at 50°C for 15 seconds, and extension at 60°C for 4 minutes.

 

FIGURE 4. Sequencing DNA template containing repeats using dGTP BigDye terminator chemistry. DNA template rich in CT- and CCTT-type repeats was sequenced in the presence of (A) 1 M betaine and (B) 5% dimethyl sulfoxide in a 20-µL reaction mix. Cycling conditions were as follows: preheat tubes at 96°C for 2 minutes, followed by 30 polymerase chain reaction cycles consisting of denaturation at 98°C for 30 seconds, annealing at 50°C for 15 seconds, and extension at 60°C for 4 minutes.

 

(AC)n and AACCCC Tandem Repeats

The sequencing results for the DNA template with (AC)n and AACCCC tandem repeats (Fig. 5) are presented as an electropherogram in Figure 6. The repeat sequence begins with a CCCCCC stretch immediately followed by a 223-bp repeat sequence of ACACACCACACCC-type. This is followed by 50 AACCCC tandem repeats in the region from 265 to 594 bp.

TTCCGTAATTTTGGAGATCGGGGCGGTTCGACTCGGCCCC 40

CCACACACCACACCCACACACCACACCCACACACCACACC 80

CACACACACCACACCCACACCCACACCACACCCACACACC 120

ACACCCACACACACACACCACACCCACACCACACCCACAC 160

CCACACACCACACCCACACACCACACCCACACCACACCCA 200

CACACCCACACACACCACACCACACCCACACACCACACAC 240

CACACCCACACACCCACACACACCCAACCCCAACCCCAAC 280

CCACACACACCAACCCCAACCCCAACCCCAACCCCAACCC 320

CAACCCCAACCCCAACCCCAACCCCAACCCCAACCCCAAC 360

CCCAACCCCCAACCCCAACCCCAACCCCAACCCCAACCCC 400

AACCCCAACCCCAACCCCAACCCCAACCCCAACCCCAACC 440

CCAACCCCAACCCCAACCCCAACCCCAACCCCAACCCCAA 480

CCCCAACCCCAACCCCAACCCCAACCCCAACCCCAACCCC 520

AACCCCAACCCCAACCCNAACCCNAACCCCNAACCCNCAA 560

CCCCAACTCCCAACCCCAACCCCAACCCAACCCNAATNTT 600

TTNTTTGGGATTGGGTTAAAGT 622

FIGURE 5. Base sequence of telomeric DNA template.

 

FIGURE 6. Representative electropherogram of DNA template with AC- and AACCCC-type tandem repeats. The template was sequenced in the presence of 1 M betaine under cycling conditions as follows: preheat tubes at 96°C for 2 minutes, followed by 30 polymerase chain reaction cycles consisting of denaturation at 98°C for 30 seconds, annealing at 50°C for 15 seconds, and extension at 60°C for 4 minutes.

 

A comparison of sequencing results of a telomeric DNA template with AC and AACCCC repeats in the presence of 1 M betaine and 5% DMSO are presented in Figure 7. The template failed to produce any sequence data under reaction conditions of preheating at 96°C for 2 minutes followed by 30 PCR cycles consisting of denaturation at 98°C for 10 seconds, annealing at 50°C for 5 seconds, and extension at 60°C for 4 minutes in the presence of 5% DMSO (Fig. 8B). The template was resequenced after increasing the annealing time from 5 to 15 seconds and the denaturation time from 10 to 30 seconds. The sequencing data between 430 and 460 bp in the presence of 1 M betaine and 5% DMSO are presented in Figure 7A and B. The sequencing data of telomeric DNA in the absence of a denaturant in the reaction mix is presented in Figure 8A. The results show that the signal strength gradually decreases in the AACCCC-repeat region, resulting in base ambiguities (Ns). Repeat sequences are known to give rise to secondary structures, through which polymerase extends inefficiently when using BigDye terminator-labeled bases. Moreover, increasing the annealing time from 5 to 15 seconds and denaturation time from 10 to 30 seconds without the addition of denaturant in the reaction mix was not sufficient to permit sequencing through the AACCCC tandem repeat region. However, after reaction of the same template in the presence of 1 M betaine or 5% DMSO, more than 500 bp of sequence data were acquired, as shown in electropherograms (Fig. 6). Addition of 1 M betaine to the reaction mix produced better signal strength and longer reads than did 5% DMSO, particularly for AACCCC repeats.

FIGURE 7. Sequencing telomeric DNA at an annealing temperature of 50°C using BigDye terminator chemistry. Telomeric DNA rich in CA- and AACCCC-type repeats was sequenced in the presence of (A) 5% dimethyl sulfoxide and (B) 1 M betaine in a 20-µL reaction mix. Cycling conditions were as follows: preheat tubes at 96°C for 2 minutes, followed by 30 polymerase chain reaction cycles consisting of denaturation at 98°C for 30 seconds, annealing at 50°C for 15 seconds, and extension at 60°C for 4 minutes.

 

FIGURE 8. Sequencing telomeric DNA in the absence of denaturant and by routine sequencing method at 50°C using BigDye terminator chemistry. Telomeric DNA rich in CA- and AACCCC-type repeats was sequenced (A) in the absence of a denaturant by preheating at 96°C for 2 minutes, followed by 30 polymerase chain reaction cycles of denaturation at 98°C for 30 seconds, annealing at 50°C for 15 seconds, and extension at 60°C for 4 minutes; and (B) by routine sequencing as described in Methods.

 

The telomeric template was also sequenced using BigDye terminator chemistry by raising the annealing temperature from 50°C to 55°C under similar sequencing parameters. The sequencing results in the region from 420 to 450 bp are shown in Figure 9A and B after annealing at the higher temperature in the presence of 5% DMSO and 1 M betaine. In the presence of 5% DMSO, the base ambiguities increased much earlier in the sequence, with increased red background from T and a drop in the signal strength (Fig. 9A). Addition of 1 M betaine to the reaction mix, however, consistently produced better sequencing results for AACCCC tandem repeats at annealing temperatures of both 50°C and 55°C (Fig. 7B and Fig. 9B).

FIGURE 9. Sequencing telomeric DNA at an annealing temperature of 55°C using BigDye terminator chemistry. Telomeric DNA rich in CA- and AACCCC-type repeats was sequenced in the presence of (A) 5% dimethyl sulfoxide and (B) 1 M betaine in a 20-µL reaction mix.

 

We also attempted to sequence the telomeric template with DYEnamic ET terminator chemistry under the sequencing conditions suggested in the manufacturer's manual.12 The sequencing data for the same template in the presence and absence and absence of 5% DMSO is shown in Figure 10. The ET dye terminator chemistry showed multiple sequence ambiguities throughout the CA repeat region and failed to produce useful sequence data for the telomeric DNA template. Thermo Sequenase II DNA polymerase (Amersham Pharmacia Biotech, Inc., Piscataway, NJ) used in the ET terminator chemistry may be denatured during the prolonged denaturation step in the reaction cycle, resulting in weak signals.12 Therefore, other sequencing conditions were not pursued using the DYEnamic ET terminator chemistry.

FIGURE 10. Sequencing telomeric DNA using DYEnamic ET terminator chemistry. Telomeric DNA rich in CA- and AACCCC-type repeats was sequenced in (A) the presence and (B) the absence of 5% dimethyl sulfoxide in a 20-µL reaction mix. Polymerase chain reaction (PCR) cycling conditions were as according to the manufacturer's protocol: 30 PCR cycles consisting of denaturation at 95°C for 20 seconds, annealing at 50°C for 15 seconds, and extension at 60°C for 1 minute.

 

DISCUSSION

Tandemly repeated sequence elements are distributed throughout the telomeric and centromeric regions of the chromosome. Even in the fully sequenced genomes, unfinished gaps in these repeat regions of DNA sequence remain to be closed. Addition of 5% DMSO or 1 M betaine to the reaction mixture have been suggested for sequencing the GC-rich templates.13,14 The recurring problem seen here in the repeat regions of the templates was due to increased T background, although T is not the lowest signal. The increased T background has been reported to be the result of the software scaling up the low T signal.15 Although high extension temperature discourages secondary structure formation, the presence of secondary structure in the DNA fragments during electrophoresis may still account for band compression. Substitution of the base analog dITP in place of dGTP is known to eliminate most compression in DNA with high GC content, but templates with tandem repeats can be difficult to sequence even with kits containing dITP.

No single sequencing chemistry works perfectly with heterogeneously prepared DNA templates. Three different dye terminator cycle sequencing chemistries were used to sequence telomeric DNA with tandem repeats and a DNA template with dinucleotide and tetranucleotide repeats. Under our reaction conditions, the best results were obtained with BigDye terminator chemistry in the presence of a denaturant. Presence of 1 M betaine in the reaction mixture produced better results and longer reads than did 5% DMSO, particularly for AACCCC-type repeats (Fig. 6). Increasing the annealing temperature from 50°C to 55°C slightly improved the signal strength in the presence of both 1 M betaine and 5% DMSO but the read length was shorter owing to increased base ambiguities (Ns) after 390 bp, as shown in Figure 9. Similarly, 1 M betaine yielded better sequencing results for the template with CTTT- and TTCC-type tetranucleotide repeats using BigDye terminator chemistry. Presence of 1 M betaine in the reaction mixture helped to sequence through the TTCC tandem repeats unambiguously (Fig. 2), whereas 5% DMSO and other reaction conditions failed to permit sequencing of this region (Figs. 3 and 4). It is concluded from these experiments that successful sequencing of templates with dinucleotide and tetranucleotide repeats and tandem repeats can be achieved by varying a combination of parameters, including annealing and denaturation times, the type of denaturant in the reaction mixture, and the type of sequencing chemistry. Clearly, there is no single method for sequencing difficult templates with repeat regions. However, applying a combination of available sequencing protocols may be effective in overcoming the sequencing difficulties in tandemly repeated telomeric DNA templates.

 

ACKNOWLEDGMENTS

The authors acknowledge the Lerner Research Institute for supporting the Molecular Biotechnology Core Laboratory. We also acknowledge Sarah Lee from Charles Bevin's laboratory and Alo Ray from Kurt W. Runge's laboratory for providing the DNA templates.

 

REFERENCES

1. Lee LG, Spurgeon SL, Heiner CR, et al. New energy transfer dyes for DNA sequencing. Nucleic Acids Res 1997;25:2816-2822.

2. Kukanskis KA, Siddiquee Z, Shohet RV, Garner HR. Mix of sequencing technologies for sequence closure: an example. BioTechniques 2000;28:630-634.

3. Mytelka DS, Chamberlin MJ. Analysis and suppression of DNA polymerase pauses associated with trinucleotide consensus. Nucleic Acids Res 1996;24:2774-2781.

4. Copenhaver GP, Nickel K, Kuromori T, et al. Genetic definition and sequence analysis of Arabidopsis centromeres. Science 1999;286:2468-2473.

5. Agudo M, Losada A, Abad JP, Pimpinelli S, Ripoll P, Villasante A. Centromeres from telomeres? The centromeric region of the Y chromosome of Drosophila melanogastor contains a tandem array of telomeric HeT-A and TART-related sequences. Nucleic Acids Res 1999;27:3318-3324.

6. Richards EJ, Goodman HM, Ausubel FM. The centromere region of Arabidopsis thaliana chromosome 1 contains telomere-similar sequences. Nucleic Acids Res 1991;19:3351-3357.

7. Blackburn EH. Telomerases. Annu Rev Biochem 1992;61:113-129.

8. Biessmann H, Kasravi B, Bui T, Fujiwara G, Champion LE, Mason JM. Comparison of two active HeT-A retroposons of Drosophila melanogaster. Chromosoma 1994;103:90-98.

9. Adams PS, Dolejsi MK, Hardin S, Mische S, Nanthakamur B, Riethman H, Rush J, Morrison P. DNA sequencing of a moderately difficult template: evaluation of the results from a Thermus thermophilus unknown test sample [abstract B-26]. Presented at the 8th Annual Genome Sequencing and Analysis Conference, Hilton Head, SC, 1996.

10. Thannhauser T, Adams PS, Dolejsi MK, Grills G, Hardin S, Robertson M. Effects of Different DNA Sequencing Methods on Accuracy, Quality and Expansion of a Web-Based Sequencing Resource: Results of the ABRF DNA Sequencing Group 1999 Study. Accessed November 5, 1999. Available at: http://www.abrf.org/ABRF/ResearchCommittees/dsrg_members.html#Electronic_Posters

11. Odelberg SJ, Weiss RB, Hata A, White R. Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I. Nucleic Acids Res 1995;23:2049-2057.

12. Amersham Pharmacia Biotech. (1999) DYEnamic ET terminator cycle sequencing premix kit manual. Piscataway, NJ: Amersham Pharmacia Biotech, 1999:6-14.

13. Burgett SG, Rosteck PR Jr. Use of dimethyl sulfoxide to improve fluorescent Taq cycle sequencing. In: Adams MD, Fields C, Venter JC, eds. Automated DNA Sequencing and Analysis. San Diego: Academic Press, 1994:211-215.

14. Henke W, Herdel K, Jung K, Schnorr D, Loening SA. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res 1997;25:3957-3958.

15. PE Biosystems. Automated DNA Sequencing Chemistry Guide. In: Data Evaluation and Troubleshooting. Foster City, CA: PE Biosystems, 1999:7-15.

 


Return to table of contents